DNA sequence (or subset thereof), to which the domain is specific
A recognition sequence is a DNA sequence to which a structural motif of a DNA-binding domain exhibits binding specificity. Recognition sequences are palindromes.[1]
The transcription factor Sp1 for example, binds the sequences 5'-(G/T)GGGCGG(G/A)(G/A)(C/T)-3', where (G/T) indicates that the domain will bind a guanine or thymine at this position.
The restriction endonuclease PstI recognizes, binds, and cleaves the sequence 5'-CTGCAG-3'.
A recognition sequence is different from a recognition site. A given recognition sequence can occur one or more times, or not at all, on a specific DNA fragment. A recognition site is specified by the position of the site. For example, there are two PstI recognition sites in the following DNA sequence fragment, starting at base 9 and 31 respectively. A recognition sequence is a specific sequence, usually very short (less than 10 bases). Depending on the degree of specificity of the protein, a DNA-binding protein can bind to more than one specific sequence. For PstI, which has a single sequence specificity, it is 5'-CTGCAG-3'. It is always the same whether at the first recognition site or the second in the following example sequence. For Sp1, which has multiple (16) sequence specificity as shown above, the two recognition sites in the following example sequence fragment are at 18 and 32, and their respective recognition sequences are 5'-GGGGCGGAGC-3' and 5'-TGGGCGGAAC-3'.
A recognitionsequence is a DNA sequence to which a structural motif of a DNA-binding domain exhibits binding specificity. Recognitionsequences are palindromes...
example, the nuclease EcoRI has the recognitionsequence 5'—GAATTC—3'. When the enzyme encounters this sequence, it cleaves each backbone between the...
enzymes recognize a specific sequence of nucleotides and produce a double-stranded cut in the DNA. The recognitionsequences can also be classified by the...
A nuclear localization signal or sequence (NLS) is an amino acid sequence that 'tags' a protein for import into the cell nucleus by nuclear transport....
A palindromic sequence is a nucleic acid sequence in a double-stranded DNA or RNA molecule whereby reading in a certain direction (e.g. 5' to 3') on one...
molecular biology, it is commonly used as a restriction enzyme. Recognitionsequence of NdeI: 5'CATATG 3'GTATAC The ends generated by NdeI digest: 5'---CA...
problem-solving skills, including logic, pattern recognition, sequence solving, spatial recognition, and word completion. Many puzzle games involve a...
AATT. The nucleic acid recognitionsequence where the enzyme cuts is G↓AATTC, which has a palindromic complementary sequence of CTTAA↓G. Other restriction...
by Newman, et al. (1995). BamHI binds at the recognitionsequence 5'-GGATCC-3', and cleaves these sequences just after the 5'-guanine on each strand. This...
Endonucleases differ from exonucleases, which cleave the ends of recognitionsequences instead of the middle (endo) portion. Some enzymes known as "exo-endonucleases"...
negative species, Providencia stuartii. PstI cleaves DNA at the recognitionsequence 5′-CTGCA/G-3′ generating fragments with 3′-cohesive termini. This...
EcoRV forms a homodimer in solution before binding and acting on its recognitionsequence. Initially the enzyme binds weakly to a non-specific site on the...
Isoschizomers are pairs of restriction enzymes specific to the same recognitionsequence. For example, SphI (CGTAC/G) and BbuI (CGTAC/G) are isoschizomers...
general-purpose speech recognition systems are based on hidden Markov models. These are statistical models that output a sequence of symbols or quantities...
functional attribute to the host organism. Homing endonuclease recognitionsequences are long enough to occur randomly only with a very low probability...
depends on a transcription factor binding to a (10 base or less) recognitionsequence at the enhancer that interacts with the promoter region of that gene...
repeats) is a family of DNA sequences found in the genomes of prokaryotic organisms such as bacteria and archaea. These sequences are derived from DNA fragments...
Naturally-occurring P elements contain coding sequence for the enzyme transposase and recognitionsequences for transposase action. Transposase regulates...
isolated from the bacterium Thermus aquaticus in 1978. It has a recognitionsequence of 5'TCGA 3'AGCT and makes the cut 5'---T CGA---3' 3'---AGC T---5'...
obtained by aligning all known examples of a certain recognition site and defined as the idealized sequence that represents the predominant base at each position...
sequence labeling is a type of pattern recognition task that involves the algorithmic assignment of a categorical label to each member of a sequence of...
twelve-nucleotide sequence, recognitionsequences tend to occur by chance in any long sequence. Restriction enzymes specific to hundreds of distinct sequences have...
are endodeoxyribonucleases characterized by a large recognition site (double-stranded DNA sequences of 12 to 40 base pairs); as a result this site generally...
audio signals. Sequence averaging: a GPL Java implementation of DBA. The Gesture Recognition Toolkit|GRT C++ real-time gesture-recognition toolkit implements...
TATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC. The recognitionsequence of the Alu I endonuclease is 5' ag/ct 3'; that is, the enzyme cuts...
Global Information