Global Information Lookup Global Information

Kluyveromyces lactis information


Kluyveromyces lactis
Kluyveromyces lactis yeast cuture growing on a yeast powder-dextrose culture plate; plate-specific details redacted in black
Kluyveromyces lactis yeast culture on a plate
Scientific classification Edit this classification
Domain: Eukaryota
Kingdom: Fungi
Division: Ascomycota
Class: Saccharomycetes
Order: Saccharomycetales
Family: Saccharomycetaceae
Genus: Kluyveromyces
Species:
K. lactis
Binomial name
Kluyveromyces lactis
(Stell.-Dekk.) Van der Walt

Kluyveromyces lactis is a Kluyveromyces yeast commonly used for genetic studies and industrial applications. Its name comes from the ability to assimilate lactose and convert it into lactic acid.

Kluyveromyces lactis (formerly Saccharomyces lactis) is a yeast which has the ability to assimilate lactose and convert it into lactic acid. K. lactis and other organisms i.e., Aspergillus niger var awamori and Escherichia coli K-12 are grown in fermenters to produce chymosin (rennet) on a commercial scale; this rennet, which replaces the conventional form obtained from slaughtered animals, is now widely used in cheese production.

Yeasts and fungi are ideal organisms for comparative genomic studies in eukaryotes because of their small and compact genomes and because they include a number of species such as Neurospora crassa, Saccharomyces cerevisiae and Schizosaccharomyces pombe, that have been, and continue to be, used extensively in genetic studies. However, the divergence between these three species is ancient (estimated to be at least 300 million years old) and the organization of their genomes is quite different. The diversity of the hemiascomycetes, a group of ascomycetes that contains most of the known yeast species, was first explored in 2000.

Complete sequencing and comparison of four hemiascomycetous yeasts has been undertaken for Candida glabrata, Kluyveromyces lactis, Debaryomyces hansenii, and Yarrowia lipolytica. They were selected on the basis of their phylogenetic positions and their specific interest as human pathogens, or as industrially or environmentally important yeasts. This work, which represents the first multispecies exploration of genome evolution across an entire eukaryotic phylum, reveals the variety of events and mechanisms that have taken place, and should allow useful comparisons with other phyla of multicellular organisms when more genome sequences are determined.

K. lactis is a heterothallic species with a predominantly haplontic cycle, in contrast to S. cerevisiae in which the predominantly diplobiontic cycle is pseudo-heterothallic due to mating-type switching.[1]

  1. ^ Dujon (2004). "Genome evolution in yeasts". Nature. 430 (6995): 35–44. Bibcode:2004Natur.430...35D. doi:10.1038/nature02579. PMID 15229592. S2CID 4399964.

and 29 Related for: Kluyveromyces lactis information

Request time (Page generated in 0.896 seconds.)

Kluyveromyces lactis

Last Update:

assimilate lactose and convert it into lactic acid. Kluyveromyces lactis (formerly Saccharomyces lactis) is a yeast which has the ability to assimilate lactose...

Word Count : 465

Kluyveromyces

Last Update:

mutants. Kluyveromyces is widely cultured for microbiological en genetic research. Some important species include: Kluyveromyces lactis Kluyveromyces marxianus...

Word Count : 274

Kluyveromyces marxianus

Last Update:

Kluyveromyces marxianus in ascomycetous yeast and member of the genus, Kluyveromyces. It is the sexual stage of Atelosaccharomyces pseudotropicalis [citation...

Word Count : 1515

Killer yeast

Last Update:

the K28 toxin by forming a complex with it. Killer properties of Kluyveromyces lactis are associated with linear DNA plasmids, which have on their 5'end...

Word Count : 2438

Kefir

Last Update:

strains of yeast that can metabolize lactose, such as Kluyveromyces marxianus, Kluyveromyces lactis, and Saccharomyces fragilis, as well as strains of yeast...

Word Count : 3553

Blue cheese

Last Update:

Debaryomyces hansenii and its non-sporulating form Candida famata, and Kluyveromyces lactis and its non-sporulating form Candida sphaerica. Similarly to other...

Word Count : 3235

Ethanol fermentation

Last Update:

oxygen. If oxygen is present, some species of yeast (e.g., Kluyveromyces lactis or Kluyveromyces lipolytica) will oxidize pyruvate completely to carbon dioxide...

Word Count : 2006

Lactase

Last Update:

commercially can be extracted both from yeasts such as Kluyveromyces fragilis and Kluyveromyces lactis and from molds, such as Aspergillus niger and Aspergillus...

Word Count : 2129

Chymosin

Last Update:

recombinantly in Escherichia coli, Aspergillus niger var. awamori, and Kluyveromyces lactis.[citation needed] Chymosin is found in a wide range of tetrapods...

Word Count : 1306

Hexokinase

Last Update:

Sträter, Norbert (2010). "Crystal Structure of Hexokinase KlHxk1 of Kluyveromyces lactis". Journal of Biological Chemistry. 285 (52). Elsevier BV: 41019–41033...

Word Count : 1567

HomoloGene

Last Update:

Caenorhabditis elegans" "Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Eremothecium gossypii, Magnaporthe grisea, Neurospora crassa" "Arabidopsis...

Word Count : 340

Rennet

Last Update:

trademark CHY-MAX by the Danish company Chr. Hansen, or produced by Kluyveromyces lactis and commercialized under the trademark Maxiren by the Dutch company...

Word Count : 1985

Lactose

Last Update:

"Undd Bertholetus praeparat ex sero lactis remedium, quod vocat mannam S. [alchemical symbol for salt, salem] seri lactis vid. in Encyclopaed. p. 400. Praeparatio...

Word Count : 2539

Yeast expression platform

Last Update:

substrates; it is thermo-tolerant and can assimilate nitrate (see also Kluyveromyces lactis). It has been applied to the production of hepatitis B vaccines,...

Word Count : 1048

Plasmid

Last Update:

used for genetic engineering of yeast—and linear pGKL plasmids from Kluyveromyces lactis, that are responsible for killer phenotypes. Other types of plasmids...

Word Count : 5331

Expression vector

Last Update:

produced in yeast. Another yeast used for protein production is Kluyveromyces lactis and the gene is expressed, driven by a variant of the strong lactase...

Word Count : 4178

Telomere

Last Update:

GGTGTACGGATGCAGACTCGCTT Candida guillermondii GGTGTAC Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT...

Word Count : 4840

Reverse transcription polymerase chain reaction

Last Update:

2012). "Functional analysis of the single Est1/Ebs1 homologue in Kluyveromyces lactis reveals roles in both telomere maintenance and rapamycin resistance"...

Word Count : 5540

List of microorganisms used in food and beverage preparation

Last Update:

Kloeckera javanica fungus chocolate Kluyveromyces lactis fungus cheese Kluyveromyces marxianus fungus cheese Kluyveromyces marxianus fungus chocolate Kocuria...

Word Count : 396

Paleopolyploidy

Last Update:

despite its small, compact genome (~13Mbp), after the divergence from Kluyveromyces lactis and K. marxianus. Through genome streamlining, yeast has lost 90%...

Word Count : 3070

Gene density

Last Update:

/genomes/refseq/fungi/Kluyveromyces_lactis/latest_assembly_versions/GCF_000002515.2_ASM251v1". ftp.ncbi.nih.gov. Retrieved 2020-12-31. "Kluyveromyces lactis (ID 193)...

Word Count : 4002

Mating of yeast

Last Update:

"The beta subunit of the heterotrimeric G protein triggers the Kluyveromyces lactis pheromone response pathway in the absence of the gamma subunit"....

Word Count : 5633

Glycoside hydrolase family 18

Last Update:

which includes chitinase, chitodextrinase and the killer toxin of Kluyveromyces lactis. The chitinases hydrolyse chitin oligosaccharides. Another chitinase...

Word Count : 371

Araecerus fasciculatus

Last Update:

Araecerus fasciculatus, to Volatiles from the Industrial Yeast Kluyveromyces lactis". Journal of Chemical Ecology. 43 (2): 180–187. Bibcode:2017JCEco...

Word Count : 1592

Biomolecular engineering

Last Update:

on the catalytic activity of the immobilized β-galactosidase from Kluyveromyces lactis". Biochemical Engineering Journal. 9 (1): 33–40. doi:10.1016/s1369-703x(01)00118-8...

Word Count : 5707

Phosphoribosylanthranilate isomerase

Last Update:

isomerase is also found in various forms of fungi such as Kluyveromyces lactis (yeast), Saccharomyces cerevisiae (yeast), and Ashbya gossypii. A...

Word Count : 1396

Bernard Dujon

Last Update:

studying other yeasts of biotechnological or medical interest, such as Kluyveromyces lactis and Candida glabrata. In Gif-sur-Yvette, Bernard Dujon started to...

Word Count : 3898

Anthranilate phosphoribosyltransferase

Last Update:

There are homologues of AnPRT within Saccharomyces cerevisiae, Kluyveromyces lactis, Schizosaccharomyces pombe, Magnaporthe grisea, Neurospora crassa...

Word Count : 671

Microbial hyaluronic acid production

Last Update:

Genetically modified producers were developed such as Kluysveromyces  lactis,  Lactococcus  lactis, Bacillus  subtilis, Escherichia  coli,  and Corynebacterium...

Word Count : 2121

PDF Search Engine © AllGlobal.net