Bacteriophage T7 Structural Model at Atomic Resolution[1]
Escherichia virus T7
Virus classification
(unranked):
Virus
Realm:
Duplodnaviria
Kingdom:
Heunggongvirae
Phylum:
Uroviricota
Class:
Caudoviricetes
Order:
Caudovirales
Family:
Autographiviridae
Genus:
Teseptimavirus
Species:
Escherichia virus T7
Bacteriophage T7 (or the T7 phage) is a bacteriophage, a virus that infects bacteria. It infects most strains of Escherichia coli and relies on these hosts to propagate. Bacteriophage T7 has a lytic life cycle, meaning that it destroys the cell it infects. It also possesses several properties that make it an ideal phage for experimentation: its purification and concentration have produced consistent values in chemical analyses;[2] it can be rendered noninfectious by exposure to UV light;[3] and it can be used in phage display to clone RNA binding proteins.[3]
^Dr. Victor Padilla-Sanchez, PhD (2021-07-10), Bacteriophage T7 Structural Model at Atomic Resolution., doi:10.5281/zenodo.5133295, retrieved 2021-07-24
^Studier, F. William (1969-11-01). "The genetics and physiology of bacteriophage T7". Virology. 39 (3): 562–574. doi:10.1016/0042-6822(69)90104-4. ISSN 0042-6822. PMID 4902069.
^ abTeesalu, Tambet; Sugahara, Kazuki N.; Ruoslahti, Erkki (1 January 2012). "Mapping of Vascular ZIP Codes by Phage Display". In Wittrup, K. Dane; Verdine, Gregory L. (eds.). Methods in Enzymology. Academic Press. pp. 35–56. doi:10.1016/B978-0-12-396962-0.00002-1. PMID 22230564.
Bacteriophage T7 (or the T7phage) is a bacteriophage, a virus that infects bacteria. It infects most strains of Escherichia coli and relies on these...
initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA...
bacteriophages used in phage display are M13 and fd filamentous phage, though T4, T7, and λ phage have also been used. Phage display was first described...
T7 or T-7 may refer to: Thoracic vertebra 7 Thoracic spinal nerve 7 T7phage, a virus used in the study of biological systems T7 DNA Helicase, a hexameric...
possesses a gene that is expressed to produce T7 RNA polymerase. (This polymerase originates from the T7phage, a bacteriophage virus which infects E. coli...
Nucleotidyl transfer by DNA polymerase. T7 DNA polymerase catalyzes the phosphoryl transfer during DNA replication of the T7phage. As shown in Figure 2, the 3’...
T7phage in structure though the two viruses may differ in capsid maturation. FRASER, D; WILLIAMS, RC (Feb 1953). "Details of frozen-dried T3 and T7 bacteriophages...
T7 DNA helicase (gp4) is a hexameric motor protein encoded by T7phages that uses energy from dTTP hydrolysis to process unidirectionally along single...
bacteriophages. For example, T7phages have two operons. The first operon codes for various products, including a special T7 RNA polymerase which can bind...
Teseptimavirus (synonyms T7phage group, T7-like phages, T7-like viruses, T7likevirus) is a genus of viruses in the order Caudovirales, in the family Autographiviridae...
Filamentous phages retard bacterial growth but, contrasting with the lambda phage and the T7phage, are not generally lytic. Helper phages are usually...
The T7 Holin family (TC# 1.E.6) is a member of the Holin Superfamily II. Members of this family are predominantly found in Caudovirales and Pseudomonadota...
DnaG primases can have extra functions, if given the right domains. The T7phage gp4 is a DnaG primase-helicase fusion, and performs both functions in replication...
Bacteriophages (phages), potentially the most numerous "organisms" on Earth, are the viruses of bacteria (more generally, of prokaryotes). Phage ecology is...
promoter and sequence which corresponds to the mRNA construct. By combining T7phage RNA polymerase and the plasmid DNA, the mRNA can be transcribed in the...
virion include bacteriophages λ and Ε34. Many Podoviridae, for example phagesT7 and Φ29, share few DNA similarities with P22, even though their virion...
GP5 could refer to several things: GP5 (gene) T7phage, or Gp5 GP5 chip, computer chip GP-5 gas mask, Soviet civilian gas mask This disambiguation page...
when resistance is forced by mutagenesis experiments. Double-stranded DNA phage lysins tend to lie within the 25 to 40 kDa range in terms of size. A notable...
"Genomic Analysis of Pseudomonas aeruginosa Phages LKD16 and LKA1: Establishment of the φKMV Subgroup within the T7 Supergroup". Journal of Bacteriology. 188...
from Dartmouth College in 1997 for his work on genetic engineering using T7phage. Endy was a junior fellow for three years and later an Assistant Professor...
Enterobacteriaceae phages SP6 and K1-5 were the first to be considered as an estranged subgroup of the "T7 supergroup". Pseudomonas phage phiKMV also shared...
environment and mutation severity as revealed by in silico mutagenesis of phageT7. Genetics. 160:1273-1281. Schuppli, D., J. Georgijevic, and H. Weber. 2000...
(Bacillus subtilis). PUR (ROSE-8), study of space environment effect on T7phage, its DNA and of polycristalline uracil. IMBP (Institute of Biomedical Problems)...
small family that includes members derived from a number of Burkholderia phage as well as a Poloromonas species. As of April 3, 2016, this family belongs...
and cloning vectors in E. coli include plasmids, bacteriophages (such as phage λ), cosmids, and bacterial artificial chromosomes (BACs). Some DNA, however...
Global Information
