Global Information Lookup Global Information

TBX21 information


TBX21
Identifiers
AliasesTBX21, T-PET, T-bet, TBET, TBLYM, T-box 21, T-box transcription factor 21, IMD88
External IDsOMIM: 604895 MGI: 1888984 HomoloGene: 8353 GeneCards: TBX21
Orthologs
SpeciesHumanMouse
Entrez
Ensembl
UniProt
RefSeq (mRNA)

NM_013351

NM_019507

RefSeq (protein)

NP_037483

NP_062380

Location (UCSC)Chr 17: 47.73 – 47.75 MbChr 11: 96.99 – 97.01 Mb
PubMed search[3][4]
Wikidata
View/Edit HumanView/Edit Mouse

T-box transcription factor TBX21, also called T-bet (T-box expressed in T cells) is a protein that in humans is encoded by the TBX21 gene.[5] Though being for long thought of only as a master regulator of type 1 immune response, T-bet has recently been shown to be implicated in development of various immune cell subsets and maintenance of mucosal homeostasis.[6]

  1. ^ a b c GRCh38: Ensembl release 89: ENSG00000073861 – Ensembl, May 2017
  2. ^ a b c GRCm38: Ensembl release 89: ENSMUSG00000001444 – Ensembl, May 2017
  3. ^ "Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  4. ^ "Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
  5. ^ "Entrez Gene: TBX21 T-box 21".
  6. ^ Lazarevic V, Glimcher LH, Lord GM (November 2013). "T-bet: a bridge between innate and adaptive immunity". Nature Reviews. Immunology. 13 (11): 777–789. doi:10.1038/nri3536. PMC 6290922. PMID 24113868.

and 11 Related for: TBX21 information

Request time (Page generated in 0.5255 seconds.)

TBX21

Last Update:

transcription factor TBX21, also called T-bet (T-box expressed in T cells) is a protein that in humans is encoded by the TBX21 gene. Though being for...

Word Count : 2366

Corticosteroid

Last Update:

of interest are CHRH1 (corticotropin-releasing hormone receptor 1) and TBX21 (transcription factor T-bet). Both genes display some degree of polymorphic...

Word Count : 4133

TEX9

Last Update:

Hypermethylated in cancer 1 CTCTGCCCAGCCT and CTTCACCCGTGAT + and - T-box TF TBX21, dimeric binding site TACTGCTTTTGGTGTCATATCTAAG + Sine oculis homeobox homolog...

Word Count : 1202

List of distinct cell types in the adult human body

Last Update:

NT5E Eomes low Liver NK cell unknown unknown liver None None unknown None TBX21, eomes Epen_65 unknown unknown brain None None unknown None DTHD1, TNC,...

Word Count : 1208

List of human transcription factors

Last Update:

ENSG00000164532 T-box Known motif – High-throughput in vitro [905] TCACRCBYTMACACCT TBX21 ENSG00000073861 T-box Known motif – High-throughput in vitro [906] WTCACACCTH...

Word Count : 81

Immunologic constant of rejection

Last Update:

Interferon-regulatory factor 1 (IRF1), the transcription factor T-bet (TBX21). CD8 Tcell markers : CD8A & CD8B Immune effector or cytotoxic factors like...

Word Count : 2430

Experimental autoimmune encephalomyelitis

Last Update:

humans to mice, inducing MS type II demyelination (pattern II) Deficiency of TBX21 or STAT4 provides resistance against EAE, while interferon-γ-, interferon-γ-receptor-...

Word Count : 2134

TBR1

Last Update:

DNA-binding domain. Other members of the TBR1 subfamily include EOMES and TBX21. TBR1 is involved in the differentiation and migration of neurons and is...

Word Count : 3605

Indolent T cell lymphoproliferative disorder of the gastrointestinal tract

Last Update:

the rapid proliferation of CD4+ T cells that overexpress either GATA3 or TBX21, have a wide range of characteristic genetic abnormalities (see genetic...

Word Count : 3069

Biomarkers of multiple sclerosis

Last Update:

factor The autoimmune disease-associated transcription factors EOMES and TBX21 are dysregulated in multiple sclerosis and define a molecular subtype of...

Word Count : 7797

List of OMIM disorder codes

Last Update:

thoracic dystrophy 3; 613091; DYNC2H1 Asthma and nasal polyps; 208550; TBX21 Ataxia with isolated vitamin E deficiency; 277460; TTPA Ataxia, cerebellar...

Word Count : 18877

PDF Search Engine © AllGlobal.net