positive regulation of transcription, DNA-templated
cellular response to organic substance
positive regulation of isotype switching to IgG isotypes
response to virus
T cell differentiation
regulation of transcription, DNA-templated
lymphocyte migration
transcription, DNA-templated
regulation of immune response
negative regulation of transcription by RNA polymerase II
negative regulation of interleukin-2 production
proteasome-mediated ubiquitin-dependent protein catabolic process
regulation of T cell differentiation
negative regulation of transcription, DNA-templated
negative regulation of T-helper 17 cell differentiation
negative regulation of T-helper 17 cell lineage commitment
negative regulation of T-helper 2 cell cytokine production
positive regulation of gene expression
Sources:Amigo / QuickGO
Orthologs
Species
Human
Mouse
Entrez
30009
57765
Ensembl
ENSG00000073861
ENSMUSG00000001444
UniProt
Q9UL17
Q9JKD8
RefSeq (mRNA)
NM_013351
NM_019507
RefSeq (protein)
NP_037483
NP_062380
Location (UCSC)
Chr 17: 47.73 – 47.75 Mb
Chr 11: 96.99 – 97.01 Mb
PubMed search
[3]
[4]
Wikidata
View/Edit Human
View/Edit Mouse
T-box transcription factor TBX21, also called T-bet (T-box expressed in T cells) is a protein that in humans is encoded by the TBX21 gene.[5] Though being for long thought of only as a master regulator of type 1 immune response, T-bet has recently been shown to be implicated in development of various immune cell subsets and maintenance of mucosal homeostasis.[6]
^ abcGRCh38: Ensembl release 89: ENSG00000073861 – Ensembl, May 2017
^ abcGRCm38: Ensembl release 89: ENSMUSG00000001444 – Ensembl, May 2017
^"Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
^"Mouse PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
^"Entrez Gene: TBX21 T-box 21".
^Lazarevic V, Glimcher LH, Lord GM (November 2013). "T-bet: a bridge between innate and adaptive immunity". Nature Reviews. Immunology. 13 (11): 777–789. doi:10.1038/nri3536. PMC 6290922. PMID 24113868.
transcription factor TBX21, also called T-bet (T-box expressed in T cells) is a protein that in humans is encoded by the TBX21 gene. Though being for...
of interest are CHRH1 (corticotropin-releasing hormone receptor 1) and TBX21 (transcription factor T-bet). Both genes display some degree of polymorphic...
Hypermethylated in cancer 1 CTCTGCCCAGCCT and CTTCACCCGTGAT + and - T-box TF TBX21, dimeric binding site TACTGCTTTTGGTGTCATATCTAAG + Sine oculis homeobox homolog...
humans to mice, inducing MS type II demyelination (pattern II) Deficiency of TBX21 or STAT4 provides resistance against EAE, while interferon-γ-, interferon-γ-receptor-...
DNA-binding domain. Other members of the TBR1 subfamily include EOMES and TBX21. TBR1 is involved in the differentiation and migration of neurons and is...
the rapid proliferation of CD4+ T cells that overexpress either GATA3 or TBX21, have a wide range of characteristic genetic abnormalities (see genetic...
factor The autoimmune disease-associated transcription factors EOMES and TBX21 are dysregulated in multiple sclerosis and define a molecular subtype of...