Global Information Lookup Global Information

SP6 information


SP6 may refer to :

  • SP6 RNA polymerase, a RNA polymerase related to the T7 RNA polymerase
  • one of the three versions of the 9x39 mm rifle cartridge
  • a model of steam toy made by British manufacturer Mamod
  • Service pack 6 in computing
  • 4685 Karetnikov (1978 SP6), a Main-belt Asteroid discovered on September 27, 1978
  • 9154 Kolʹtsovo (1982 SP6), a Main-belt Asteroid discovered on September 16, 1982
  • Spleen 6, an acupuncture point above the ankle on the inside of the leg.
  • Specialist 6, an obsolete enlisted rank in the United States Army. See Specialist (rank).
  • Surface Pro 6, a 2-in-1 detachable tablet computer developed by Microsoft
  • Socket SP6, a CPU socket for AMD server CPUs

and 21 Related for: SP6 information

Request time (Page generated in 0.5983 seconds.)

Socket SP6

Last Update:

Socket SP6 (LGA 4844) is a zero insertion force land grid array CPU socket designed by AMD supporting its Zen 4c-based Siena Epyc server processors that...

Word Count : 420

SP6

Last Update:

SP6 may refer to : SP6 RNA polymerase, a RNA polymerase related to the T7 RNA polymerase one of the three versions of the 9x39 mm rifle cartridge a model...

Word Count : 155

Socket sTR5

Last Update:

PRO CPU and a WRX90 motherboard. Ryzen Socket sWRX8 Socket sTRX4 Socket SP6 Bonshor, Gavin (October 19, 2023). "AMD Unveils Ryzen Threadripper 7000 Family:...

Word Count : 247

Ontario Knife Company

Last Update:

version of the original Ka-Bar Mark 3 Navy diving/survival knife Spec Plus SP6 Fighter and SP13 Tango Spec Plus SP25 USN-2 Navy knife Spec Plus SP26 USN-3...

Word Count : 344

Internet Explorer 5

Last Update:

support Windows 3.1x, Windows NT 3.51, Windows 95 and Windows NT 4.0 SP3—SP6. The actual release of Internet Explorer 5 happened in three stages. First...

Word Count : 2383

Epyc

Last Update:

8004 series of CPUs, codenamed Siena. Siena utilizes a new socket, called SP6, which has a smaller footprint and pin count than the SP5 socket of its contemporary...

Word Count : 3686

Microsoft Office XP

Last Update:

Windows NT 4.0 SP6 through Windows Vista and Windows Server 2008 R2. It is the last version of Microsoft Office to support Windows NT 4.0 SP6–6A, Windows...

Word Count : 7287

T7 RNA polymerase

Last Update:

TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins...

Word Count : 1030

SUSE Linux Enterprise

Last Update:

Retrieved 8 June 2022. "Announcing the Availability of SUSE Linux Enterprise 15 SP6 – The Linux Choice for Security and Compliance in a Reliable IT". 26 June...

Word Count : 3285

Zen 3

Last Update:

new sockets, which are AM5 for the desktop "Ryzen" chips alongside SP5 and SP6 for the EPYC server platform and sTRX8. According to AMD, Zen 3 has a 19%...

Word Count : 3018

Lawrence Joel

Last Update:

gallantry and intrepidity at the risk of life above and beyond the call of duty. SP6 Joel demonstrated indomitable courage, determination, and professional skill...

Word Count : 1463

Land grid array

Last Update:

Socket sWRX8 (LGA 4094) Socket AM5 (LGA 1718) Socket SP5 (LGA 6096) Socket SP6 (LGA 4844) Socket sTR5 (LGA 4844) LGA 771 (Socket J) – Note that Socket 771...

Word Count : 1272

List of Aisin transmissions

Last Update:

Petrol & Diesel, Roewe 550, Mazda6, Mazda CX-7, Mazda CX-9, Land Rover LR2 SP6 — 6-speed Porsche 997 SA6 - 6-speed Lexus LFA April 1997– BC6 — 6-speed August...

Word Count : 1587

Microsoft Access

Last Update:

Professional, Premium and Developer Access 2002 10.0 May 31, 2001 Windows NT 4.0 SP6, Windows 98, Windows 2000, Windows Me Office XP Professional and Developer...

Word Count : 6622

Tasuku Honjo

Last Update:

cDNA encoding the murine IgG1 induction factor by a novel strategy using SP6 promoter". Nature. 319 (6055): 640–646. Bibcode:1986Natur.319..640N. doi:10...

Word Count : 1518

Visual Studio

Last Update:

version to support the Windows 9x platform, as well as Windows NT 4.0 before SP6, but after SP2. Each version of each language in part also settled to v6...

Word Count : 15451

Zen 4

Last Update:

Desktop Socket AM5 HEDT/Workstation Socket sTR5 Server Socket SP5 Socket SP6 Products, models, variants Product code names Desktop Raphael Phoenix (APUs)...

Word Count : 3998

Socket SP3

Last Update:

Naples Rome Milan Predecessor Socket C32 Socket G34 Successor Socket SP5 Socket SP6 Memory support ECC DDR4 This article is part of the CPU socket series...

Word Count : 470

Mamod

Last Update:

similar to the SP6 model in the product range but features twin cylinders. The SP7 utilizes the same boiler and burner unit as the SP6, which can be equipped...

Word Count : 6903

Environment variable

Last Update:

Application Data directory of the logged-in user. Does not work on Windows NT 4.0 SP6 UK. %LOCALAPPDATA% This variable is the temporary files of Applications....

Word Count : 10249

List of postcode districts in the United Kingdom

Last Update:

Hampshire SP SP01 SP1, SP2, SP3, SP4, SP5 Salisbury (Wiltshire) SP SP06 SP6 Fordingbridge Hampshire SP SP07 SP7 Shaftesbury Dorset SP SP08 SP8 GILLINGHAM...

Word Count : 498

PDF Search Engine © AllGlobal.net